DNA Sequencing

RealGene Research has already been proofed their advanced skills and techniques in the areas of biotechnology, genetic engineering and molecular biology. Bulk orders (96-well plates formatted):

The price will be going down depending on the amount of plates.
These samples will be formatted into each well of the plates as follow:
Add 4ul of template DNA, 150ng-160ng/ul, must be correct concentration!!!
Add 2ul of 2.5-5uMole of a primer.
Total volume in each well is 6ul, then, seal the plates tightly with strip caps or very thick gel heat-sealer films.
Note: In the sky when air-shipping, the air pressure will be reduced, leaking out and under the film will make samples lost and contaminations between wells.
High through-put capillary sequencers. Read more than 900 bases.

  • Turn-around time: two to three business days usually (P.R.Chinese)
  • Data reported electronically via e-mail

Files delieved: ABI Electropherogram and Simple Text
How to Order Sequencing Services

  • Order by three ways

1. For single order, you need to fill the Sequencing Sample Order Form here (MS Excel format), print out the order form, send us a copy of the form together with your samples, and at the same time send us an E-mail with order form attached (electronic copy).


2. For orders located in ShangHai, if you have more than 20 samples per day, we can arrange a pick-up service for you, please call us at (0086-21) 54460771 , you can also send us an inquiry via fax (0086-21)54460772.
3. For bulk orders and contract services, quotations may be needed The price per reaction is negotiable

Primers Used for Sequencing

  • Universal and often-used primers , provided without extra charge in RealGene Sequencing Lab.
  • Primers not on the list or gene specific primers (GSP) should be prepared by customers and submitted together with sequencing samples. Required concentration and amount of submitted Primers.

Concentration

Amount

     10 uMole, or 40-50ng/ul

          5 ul per reaction (2ul will be used in labeling)

. Table: Ready4U Primers *

                     Primer Names

    Oligo DNA Sequences (from 5’ to 3’)

   Bluescript KS

    TCGAGGTCGACGGTATC

    Bluescript SK

    CGCTCTAGAACTAGTGGATC

    M13 Forward (-20)

    GTAAAACGACGGCCAGTG

    M13 Forward (-41)

    GGTTTTCCCAGTCACGAC

    M13 Reverse (-27)

    GGAAACAGCTATGACCATG

    M13 Reverse (-48)

    AGCGGATAACAATTTCACAC

    pCDM8 Reverse

    TAAGGTTCCTTCACAAAG

    pCEP Forward

    AGAGCTCGTTTAGTGAACCG

    pCMV30, N-CMV30, for pFlag-CMV vect.

    AATGTCGTAATAACCCCGCCCC GTTGACGC

    pCMV24, C-CMV24, for pFlag-CMV vect.

    TATTAGGACAAGGCTGGTGGG CAC

    pCMV Forward

    CGCAAATGGGCGGTAGGCGTG

    pGEX5’

    GGGCTGGCAAGCCACGTTTGGTG

    pGEX3’

    CCGGGAGCTGCATGTGTCAGAGG

    pTRE 3'

    CCACACCTCCCCCTGAAC

    pTRE 5'

    CGCCTGGAGACGCCATCC

    pYESTrp Forward

    GATGTTAACGATACCAGCC

    pYESTrp Reverse

    GCGTGAATGTAAGCGTGAC

    SP6

    TACGATTTAGGTGACACTATAG

    T3

    CAATTAACCCTCACTAAAGG

    T7

    GTAATACGACTCACTATAGGG

    T7 Reverse, or T7T

    GCTAGTTATTGCTCAGCGG

  >>>ÏÂÒ»Ò³
Copyright 2003-2008 Realgene Biotech,Inc. All Rights Reserved. »¦ICP±¸08008764ºÅ
Building A, No. 328 Wuhe Road,Minhang District 201109,Shanghai,China
Tel:+86-21-54460771  +86-21-54460772   Fax:+86-21-54460771/2-813   E-mail:
info@realgene.com.cn